ID: 1018287806_1018287808

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018287806 1018287808
Species Human (GRCh38) Human (GRCh38)
Location 6:162259291-162259313 6:162259308-162259330
Sequence CCGTGAGAACAACAGGTAGGATC AGGATCCATAATTGTAAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 110} {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!