ID: 1018297492_1018297503

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1018297492 1018297503
Species Human (GRCh38) Human (GRCh38)
Location 6:162364706-162364728 6:162364746-162364768
Sequence CCAGAAAATGGCTGCACAACTGA AAGGGGAATCAGGAAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 157} {0: 1, 1: 0, 2: 5, 3: 78, 4: 800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!