ID: 1018308111_1018308117

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1018308111 1018308117
Species Human (GRCh38) Human (GRCh38)
Location 6:162479619-162479641 6:162479637-162479659
Sequence CCACCTCCACTCACATCTGGTCC GGTCCCACTGGAGGGTCTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 589} {0: 1, 1: 14, 2: 300, 3: 517, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!