ID: 1018327760_1018327765

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1018327760 1018327765
Species Human (GRCh38) Human (GRCh38)
Location 6:162692290-162692312 6:162692339-162692361
Sequence CCACACACATTCTAAAGAAAAGA GGATATAACCTCTAAGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 489} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!