ID: 1018331887_1018331889

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1018331887 1018331889
Species Human (GRCh38) Human (GRCh38)
Location 6:162738085-162738107 6:162738116-162738138
Sequence CCTCACTAAGAGAGCCACAGCTT CTCTGTCCTTTCATTCCTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!