ID: 1018331887_1018331891

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1018331887 1018331891
Species Human (GRCh38) Human (GRCh38)
Location 6:162738085-162738107 6:162738124-162738146
Sequence CCTCACTAAGAGAGCCACAGCTT TTTCATTCCTAGAGGCAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 209} {0: 1, 1: 0, 2: 2, 3: 12, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!