ID: 1018336095_1018336100

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018336095 1018336100
Species Human (GRCh38) Human (GRCh38)
Location 6:162791711-162791733 6:162791743-162791765
Sequence CCCATCAATTTGAATTTCACCAT ACTGCATTCTAGAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 294} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!