ID: 1018336096_1018336101

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018336096 1018336101
Species Human (GRCh38) Human (GRCh38)
Location 6:162791712-162791734 6:162791744-162791766
Sequence CCATCAATTTGAATTTCACCATT CTGCATTCTAGAAGGAGGATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!