ID: 1018336097_1018336105

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018336097 1018336105
Species Human (GRCh38) Human (GRCh38)
Location 6:162791730-162791752 6:162791778-162791800
Sequence CCATTCAGTACTTACTGCATTCT GTAATGTGTAGTTTTAAACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 255} {0: 1, 1: 0, 2: 2, 3: 19, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!