ID: 1018352336_1018352340

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1018352336 1018352340
Species Human (GRCh38) Human (GRCh38)
Location 6:162973104-162973126 6:162973135-162973157
Sequence CCTAGTACGGTAAAGTGATGCTG GATTGCTATGGATTTTGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!