ID: 1018363502_1018363509

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1018363502 1018363509
Species Human (GRCh38) Human (GRCh38)
Location 6:163096239-163096261 6:163096264-163096286
Sequence CCCATAGCAGCACCCCAGGGTGC CCGCACCAGCCCAGTCTCGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!