ID: 1018379974_1018379976

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018379974 1018379976
Species Human (GRCh38) Human (GRCh38)
Location 6:163249875-163249897 6:163249897-163249919
Sequence CCTTTGTTCTCAAAAGGGAAGTG GACGCCAGCTGGCCAGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 197} {0: 1, 1: 0, 2: 4, 3: 18, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!