ID: 1018384342_1018384351

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018384342 1018384351
Species Human (GRCh38) Human (GRCh38)
Location 6:163289677-163289699 6:163289725-163289747
Sequence CCTGTACTAGTCCAGGAGGGAGT AGGAAATGAAGACCGGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!