ID: 1018400605_1018400628

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1018400605 1018400628
Species Human (GRCh38) Human (GRCh38)
Location 6:163415526-163415548 6:163415578-163415600
Sequence CCCGCCGGTGCCGGACGCCCCCT CCAAGTTGGCGCGTTGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 91} {0: 1, 1: 0, 2: 0, 3: 0, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!