ID: 1018425329_1018425334

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1018425329 1018425334
Species Human (GRCh38) Human (GRCh38)
Location 6:163674855-163674877 6:163674882-163674904
Sequence CCACATTTTGATCTGGTGAGTAA CAGAGTGAAGAGGGGGAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 154, 4: 1118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!