ID: 1018485936_1018485940

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1018485936 1018485940
Species Human (GRCh38) Human (GRCh38)
Location 6:164241220-164241242 6:164241256-164241278
Sequence CCACTTTCATTCTGCTGATAAAG TGGATAATTTATAAAGACAGAGG
Strand - +
Off-target summary {0: 3, 1: 43, 2: 1640, 3: 2795, 4: 2614} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!