ID: 1018527490_1018527500

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1018527490 1018527500
Species Human (GRCh38) Human (GRCh38)
Location 6:164729075-164729097 6:164729125-164729147
Sequence CCCACACAGAGCCTTCACTGAGG GGCCACTGTCCTCCAGACCCTGG
Strand - +
Off-target summary No data {0: 11, 1: 29, 2: 65, 3: 111, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!