ID: 1018529034_1018529044

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1018529034 1018529044
Species Human (GRCh38) Human (GRCh38)
Location 6:164743500-164743522 6:164743543-164743565
Sequence CCCATAACATGCCCAATGTGAAA CTTTAGAGAACCCTCTATTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 66, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!