ID: 1018551341_1018551350

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1018551341 1018551350
Species Human (GRCh38) Human (GRCh38)
Location 6:165001851-165001873 6:165001886-165001908
Sequence CCGCAGCTGCTGGCCCTGGTACT GCCCGGGGCCACTGCCCACCCGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 315, 3: 548, 4: 798} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!