ID: 1018551342_1018551360

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1018551342 1018551360
Species Human (GRCh38) Human (GRCh38)
Location 6:165001864-165001886 6:165001913-165001935
Sequence CCCTGGTACTAAGCCCCTCACTG CGTGCTGGCCCGCGAGCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 21, 2: 719, 3: 800, 4: 578} {0: 1, 1: 0, 2: 3, 3: 10, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!