ID: 1018551343_1018551359

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018551343 1018551359
Species Human (GRCh38) Human (GRCh38)
Location 6:165001865-165001887 6:165001912-165001934
Sequence CCTGGTACTAAGCCCCTCACTGC TCGTGCTGGCCCGCGAGCGCTGG
Strand - +
Off-target summary {0: 11, 1: 569, 2: 664, 3: 424, 4: 308} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!