ID: 1018577705_1018577714

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1018577705 1018577714
Species Human (GRCh38) Human (GRCh38)
Location 6:165276753-165276775 6:165276779-165276801
Sequence CCTTCCTCCTCATCCTCATGGAA CGGGGACCAAGGATTGCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 573} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!