ID: 1018587812_1018587814

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1018587812 1018587814
Species Human (GRCh38) Human (GRCh38)
Location 6:165382235-165382257 6:165382260-165382282
Sequence CCTTGAATAGATGATTCTCAACA CCTTCCAGCCCTTAATCATAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 224} {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!