ID: 1018596551_1018596552 |
View in Genome Browser |
Spacer: 20 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1018596551 | 1018596552 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:165487254-165487276 | 6:165487297-165487319 |
| Sequence | CCTGTCTTTGTGAAGCAGGGTTT | AATGAGATTACAGAGTAGCCTGG |
| Strand | - | + |
| Off-target summary | {0: 7, 1: 30, 2: 30, 3: 30, 4: 194} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||