ID: 1018612112_1018612121

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018612112 1018612121
Species Human (GRCh38) Human (GRCh38)
Location 6:165656455-165656477 6:165656503-165656525
Sequence CCGAGGACTCTGCCACCAAGATC ATCCCAGCTCCAGCACAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 193} {0: 1, 1: 0, 2: 8, 3: 52, 4: 394}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!