ID: 1018635925_1018635932 |
View in Genome Browser |
Spacer: 29 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1018635925 | 1018635932 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:165859439-165859461 | 6:165859491-165859513 |
| Sequence | CCTCCTTCCCTTGGGGGCCACTT | TATTATAAGGGATATTACAAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 7, 1: 118, 2: 318, 3: 406, 4: 759} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||