ID: 1018652141_1018652155

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1018652141 1018652155
Species Human (GRCh38) Human (GRCh38)
Location 6:166001594-166001616 6:166001630-166001652
Sequence CCAGTGCCCGCCAGAGTTTGCAG GAAGACAGGCACAGAGCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!