ID: 1018662752_1018662754

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1018662752 1018662754
Species Human (GRCh38) Human (GRCh38)
Location 6:166103309-166103331 6:166103344-166103366
Sequence CCAACTTCAAGGTCTTGCAGTAT GTGCACTGCTCAGGATCACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!