ID: 1018708053_1018708055

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018708053 1018708055
Species Human (GRCh38) Human (GRCh38)
Location 6:166477080-166477102 6:166477097-166477119
Sequence CCAGCGGGGTTTTCAGACTACCT CTACCTGGCTCCAGCTCCGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!