ID: 1018709642_1018709651

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1018709642 1018709651
Species Human (GRCh38) Human (GRCh38)
Location 6:166488887-166488909 6:166488936-166488958
Sequence CCCCACTGAGGAACTGCGGCATC CCTATTTTAGGATCTATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 82} {0: 1, 1: 0, 2: 0, 3: 22, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!