ID: 1018725827_1018725831

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1018725827 1018725831
Species Human (GRCh38) Human (GRCh38)
Location 6:166612800-166612822 6:166612819-166612841
Sequence CCTCTCTCTCTCCATGCCCTTGA TTGACCTGTCCTCCTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 696} {0: 1, 1: 0, 2: 4, 3: 33, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!