ID: 1018734790_1018734804

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018734790 1018734804
Species Human (GRCh38) Human (GRCh38)
Location 6:166679722-166679744 6:166679754-166679776
Sequence CCGGAGCCGGCTCTCTCTGCTGG GTGGAGGGAGCGGCGCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 134, 3: 703, 4: 882} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!