ID: 1018735720_1018735725

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018735720 1018735725
Species Human (GRCh38) Human (GRCh38)
Location 6:166685935-166685957 6:166685952-166685974
Sequence CCATGCCCTAGGAGGGAGGGGGA GGGGGACAGAGGGCGAACGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 289} {0: 1, 1: 0, 2: 0, 3: 15, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!