|
Left Crispr |
Right Crispr |
| Crispr ID |
1018753624 |
1018753632 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:166829465-166829487
|
6:166829484-166829506
|
| Sequence |
CCCGTAGTCCCAGCTACTCCAGA |
CAGAGGCTAAGGAAGGAGAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1302, 1: 9603, 2: 118577, 3: 247901, 4: 241623} |
{0: 1, 1: 21, 2: 777, 3: 6738, 4: 86879} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|