ID: 1018757498_1018757521

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018757498 1018757521
Species Human (GRCh38) Human (GRCh38)
Location 6:166862763-166862785 6:166862810-166862832
Sequence CCTCCCCAGCCCGCCGCGCCTCC CGCCGCAGAACGGGAGGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!