ID: 1018764314_1018764322

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1018764314 1018764322
Species Human (GRCh38) Human (GRCh38)
Location 6:166920645-166920667 6:166920689-166920711
Sequence CCAGGAGCCTTAAGGCTGTAAGG ATTGGCTTCCTGGCCTCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123} {0: 1, 1: 1, 2: 12, 3: 91, 4: 692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!