ID: 1018767474_1018767480

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1018767474 1018767480
Species Human (GRCh38) Human (GRCh38)
Location 6:166945343-166945365 6:166945368-166945390
Sequence CCTCTTCATCACGCCTCCCCAGA CCATTCCCTGCAGTGAGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 190} {0: 1, 1: 0, 2: 1, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!