ID: 1018778663_1018778668

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1018778663 1018778668
Species Human (GRCh38) Human (GRCh38)
Location 6:167043159-167043181 6:167043184-167043206
Sequence CCTCTGTGTGGCTCTGCTGTGGT TGGTTCATGAAGGACATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 285} {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!