ID: 1018789244_1018789246

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1018789244 1018789246
Species Human (GRCh38) Human (GRCh38)
Location 6:167133648-167133670 6:167133671-167133693
Sequence CCATAATTTTGATTTAGTTTATG TTGTATCTACAGATCGATTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 19, 3: 260, 4: 1303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!