ID: 1018789342_1018789355

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1018789342 1018789355
Species Human (GRCh38) Human (GRCh38)
Location 6:167134705-167134727 6:167134751-167134773
Sequence CCTAGCTGCTCCCGCTTGGCATG CAGGGAAAAGAGGAGGAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 26, 3: 233, 4: 2071}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!