ID: 1018812620_1018812636

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1018812620 1018812636
Species Human (GRCh38) Human (GRCh38)
Location 6:167308607-167308629 6:167308645-167308667
Sequence CCTTGCTGGGGCTGGGGCCCCTA GGGAGTGCAGAGGAGTGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 308} {0: 1, 1: 0, 2: 21, 3: 397, 4: 3440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!