ID: 1018812898_1018812899

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1018812898 1018812899
Species Human (GRCh38) Human (GRCh38)
Location 6:167310201-167310223 6:167310237-167310259
Sequence CCATGACTTATCTGAACTTACAT TATTTACACATTAAATGAAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 187} {0: 2, 1: 2, 2: 1, 3: 78, 4: 647}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!