ID: 1018816062_1018816069

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018816062 1018816069
Species Human (GRCh38) Human (GRCh38)
Location 6:167332219-167332241 6:167332267-167332289
Sequence CCTCCTGTTTGTTACAGCACGGG AGCAGTTGGCTGCCTGTGGTCGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 35, 3: 122, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!