ID: 1018855318_1018855327

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1018855318 1018855327
Species Human (GRCh38) Human (GRCh38)
Location 6:167670403-167670425 6:167670430-167670452
Sequence CCTCCCTGGAGGGACCTCCCCCA AAACCCTGCTCCAGAAGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 383} {0: 1, 1: 0, 2: 1, 3: 12, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!