ID: 1018855320_1018855326

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018855320 1018855326
Species Human (GRCh38) Human (GRCh38)
Location 6:167670407-167670429 6:167670429-167670451
Sequence CCTGGAGGGACCTCCCCCACATG GAAACCCTGCTCCAGAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 167} {0: 1, 1: 0, 2: 6, 3: 13, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!