ID: 1018855321_1018855333

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1018855321 1018855333
Species Human (GRCh38) Human (GRCh38)
Location 6:167670417-167670439 6:167670455-167670477
Sequence CCTCCCCCACATGAAACCCTGCT GTCTCAGCCTGCATTCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224} {0: 1, 1: 0, 2: 1, 3: 29, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!