ID: 1018899990_1018899998

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1018899990 1018899998
Species Human (GRCh38) Human (GRCh38)
Location 6:168046266-168046288 6:168046304-168046326
Sequence CCTGTGCCCACATGCGGCTCAGG GTGGTGGTCCTGACTCATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!