ID: 1018903247_1018903252

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1018903247 1018903252
Species Human (GRCh38) Human (GRCh38)
Location 6:168061608-168061630 6:168061621-168061643
Sequence CCCATCTATAGAATTCCACTCCA TTCCACTCCAGGCAGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 1022} {0: 1, 1: 0, 2: 2, 3: 32, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!