ID: 1018903429_1018903434

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1018903429 1018903434
Species Human (GRCh38) Human (GRCh38)
Location 6:168062487-168062509 6:168062506-168062528
Sequence CCCACGCCTGCAGGGCCAGGGCC GGCCAGGCACAAAGCCCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 362} {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!