ID: 1018903430_1018903443

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1018903430 1018903443
Species Human (GRCh38) Human (GRCh38)
Location 6:168062488-168062510 6:168062538-168062560
Sequence CCACGCCTGCAGGGCCAGGGCCA CCCTGATGCCCCCGAGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 51, 4: 432} {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!